Location:Home > More > Turbo HOLSET › Undefined > Vitamin D analog EB1089 triggers dramatic lysosomal changes and Beclin 1

Vitamin D analog EB1089 triggers dramatic lysosomal changes and Beclin 1

Time:2018-02-11 12:53Turbochargers information Click:

triggers analog Vitamin EB1089

Cell culture and treatments

The MCF-7S1 cell line is a subclone of the human ductal breast carcinoma cell line MCF-7 selected for high TNF sensitivity, and HeLa cell line originates from a human cervix carcinoma (kindly provided by Jiri Bartek, Danish Cancer Society, Copenhagen, Denmark). The cells were cultured in RPMI 1640 with Glutamax (Life Technologies, Lts., Paisley, UK) supplemented with 6% heat-inactivated fetal calf serum (FCS; Biological Industries, Kib. Beit Haemek, Israel), 100 U/ml penicillin and 100 μg/ml streptomycin. The medium of the stably transfected cells contained also 400 μg/ml Geneticin sulfate (G-418; Invitrogen, Carlsbad, CA, USA). The cells were maintained in a humidified atmosphere at 37°C, 5% CO2, 21% O2, 74% N2, and regularly tested and found negative for mycoplasma infection.

EB1089 and 1,25-dihydroxyvitamin D3 were kindly provided by Christina Mørk Hansen and Lise Binderup (LEO Pharmaceutical Products, Ballerup, Denmark) and human TNF by Anthony Cerami (Kenneth Warren Laboratories, Tarrytown, NY, USA). TG, rapamycin, tamoxifen and 3-MA were purchased from Sigma-Aldrich (St. Louis, MO, USA). For 2-, 3- and 5-day experiments, cells were seeded at densities 16–30 000, 8–15 000 and 3–6000 cells/cm2, respectively, 20 h before the indicated treatments. Tamoxifen-treated cells and the corresponding vehicle-treated cells were cultured in a phenol red-free DMEM/F12 medium (Life Technologies) containing 18% active coal-stripped FCS (kindly provided by Jan Stenvang Jepsen, Danish Cancer Society).

Cloning and transfections

Cells were transfected by electroporation (960 μF, 330 V) essentially as described previously, and when indicated single cell clones were obtained by limited dilution. The cDNA encoding for human LC3-β protein was PCR amplified from MCF10A cDNA library (kindly provided by Mads Daugaard Jensen, Danish Cancer Society) by a standard procedure employing Pfu Turbo Polymerase (Stratagene, La Jolla, CA, USA), 5′-end primer containing an XhoI restriction enzyme cleavage site and bases 80–99 (5′CTCGAGGCACCATGCCGTCGGAGAAG3′) of the LC3-β sequence (NM_022818) and 3′-end primer (5′GATCTCAGTTGGTAACACCC3′) complementary to bases 521–540 of LC3-β. In order to create the pDsRed-LC3-β plasmid, the obtained PCR product was cloned into pCR2.1-TOPO (Invitrogen, Paisley, UK), cleaved with XhoI and EcoRI and subcloned in frame downstream of the DsRed1 sequence in pDsRed1-C1 (kindly provided by Juliane Jürgensmeier, University of Cologne, Germany). The appropriate sequence was confirmed by sequencing (Microsynth GmbH, Lindau, Switzerland). The pCR3.1-FLAG-Beclin was kindly provided by Beth Levine (Columbia University, New York, NY, USA) and pH2B-eGFP-N1 encoding for a fusion protein consisting of histone 2B and eGFP was a gift from Christian Holmberg (University of Copenhagen, Denmark).

Two nonoverlapping siRNAs corresponding to the human cDNA sequence for beclin-1 (5′CAGTTTGGCACAATCAATA3′ and 5′CAGGAACTCACAGCTCCAT3′) and a control siRNA (5′CGACCGAGACAAGCGCAAG3′) where purchased from Dharmacon Research (USA). MCF-7 and HeLa cells were transfected with 50 and 25 nM siRNA, respectively, applying oligofectamin (Invitrogen) as a transfection agent.

Measurement of cell viability and death

The viability of cells was analyzed by the MTT reduction assay as described previously. The DNA fragmentation (cytosolic histone-bound DNA) was determined using the Cell Death Detection ELISAplus kit (Roche, Mannheim, Germany) and a microtiter plate reader (VERSAmax, Molecular Devices LTd, Crawley, UK) according to the manufacture's instructions. The results were normalized to the cell number in cultures treated in parallel, and displayed as arbitrary units. Phase contrast pictures were taken with an inverted Olympus IX-70 microscope connected to an Olympus C-5050 digital camera using × 20 objective with numerical aperture 1.1.±0.5. Image processing was performed with Adobe Photoshop 7.0. Membrane integrity was analyzed by staining cells with 1–2 μM SYTOX Green (S-7020, Molecular Probes) for 10 min, washed in PBS supplemented with 5% FCS and analysed by the FL1-H channel of flow cytometry (Becton Dickinson, San Jose, CA, USA).

Visualization and analyses of intracellular vacuoles

The acidic compartment of cells was analyzed by labeling the cells with 50 nM lysotracker-red (Molecular Probes, Eugene, OR, USA) for 10–15 min and applying Zeiss Axiovert 100 M Confocal Laser Scanning Microscope equipped with LSM510 system using × 40 Plan-neofluar objective with numerical aperture 1.3.

MDC (Sigma-Aldrich) was applied to the cells at 50 μM for 30–45 min followed by 10 min incubation with 40 mM NH4Cl in order to reduce the lysosomal staining and one wash with phosphate-buffered saline (PBS) plus 10% FCS. NH4Cl treatment was omitted when costaining with lysotracker-red. Pictures were taken on an inverted fluorescence microscope (Olympus IX-70) with Olympus C-5050 digital camera. The intracellular MDC-fluorescence (excitation 355 nm, emission 460, cutoff 550, well-scan) was quantified by a Spectramax Gemini fluorometer (Molecular Devices, Sunnyvale, CA, USA). The MDC fluorescence intensity was correlated to cell density as measured by MTT reduction assay performed in parallel treated samples. The results are expressed as fluorescence/cell relative to untreated control cells.

DsRed1-LC3-β translocation

Copyright infringement? Click Here!

Related reading
Related recommend